Archive Page

June 12, 2008
Biology, 1st – 4th periods
Mrs. Sabo
THURSDAY

OBJECTIVES:

To become familiar with the basic transformation method by transforming E.coli with a plasmid carrying genes for B-Gal production and Ampicillin Resistance.
To show how organisms can “evolve,” or change their characteristics by the absorption and use of plasmids (circular pieces of DNA that contain extra genes).
To use sterile technique and perform a controlled experiment to show that you know how to conduct scientific research efficiently, accurately and successfully.

CLASS OUTLINE:

Journal Question

Why did we put on ice for 2 minutes after the 42 degree water bath, heat shock?
Why did we incubate at 37 degrees Celcius after adding LB to our tubes on Tuesday?
Why did we plate our C and pBLU group on the LB plates yesterday?

Today we will go through all the steps of our transformation procedure to make sure you understand why each step happened and how it helped with the transformation process.
We will then secure our data tables into our lab notebooks and make our hypotheses on what we think should have happened in each tube.
Our plates will then be removed from the incubator and inspected for E. coli colony growth, record colonies and make observations in your lab notebook.
Return plates to teacher, complete data table and make graph of data.
Answer analysis questions in lab notebook in complete sentences. This is your post-lab.
Work on review sheet if extra time – Due June 17th.

HOMEWORK:

Finish data table, graph, or analysis questions for lab.

Review Sheet work. It will be due on Tuesday, June17th. It will be graded and is a required assignment.

June 11, 2008
Biology, 1st – 4th periods
Mrs. Sabo
WEDNESDAY

OBJECTIVES:

To become familiar with the basic transformation method by transforming E.coli with a plasmid carrying genes for B-Gal production and Ampicillin Resistance.
To show how organisms can “evolve,” or change their characteristics by the absorption and use of plasmids (circular pieces of DNA that contain extra genes).
To use sterile technique and perform a controlled experiment to show that you know how to conduct scientific research efficiently, accurately and successfully.

CLASS OUTLINE:

Journal Questions – “why was CaCl added to the tubes?” and “why did we put the E. coli into the 42 degree Celcius water bath?”
Short lecture on the steps of the procedure from yesterday
Prep for Day 2 procedure

Today we will plate our organisms.
Label plates with group members names
Label one LB plate as “Control” and one as “pBLU”
Label one Xgal/Amp Plate as “Control” and one as “pBLU”
Changing tips each time, squirt 250 ul of your Control group E. coli onto the LB plate labeled “Control,” then repeat by squirting 250 ul of your control group E. coli onto the Xgal/Amp Plate labeled “Control.”
Repeat this step by plating 250 ul of your pBLU group on to both the LB and Xgal/Amp plates.
Use a spreader to spread your solution over the entire surface of your Petri dish.
Let sit for 5 minutes, then turn upside down and give to Mrs. Sabo to incubate at 37 degrees Celcius for 24 hours.

See power point on Transformation Procedures for class outline.

HOMEWORK:
Review Sheet work. It will be due on Tuesday, June17th. It will be graded and is a required assignment.

June 9, 2008
Biology, 1st – 4th periods
Mrs. Sabo
MONDAY

OBJECTIVES:

To become familiar with the basic transformation method by transforming E.coli with a plasmid carrying genes for B-Gal production and Ampicillin Resistance.
To show how organisms can “evolve,” or change their characteristics by the absorption and use of plasmids (circular pieces of DNA that contain extra genes).
To use sterile technique and perform a controlled experiment to show that you know how to conduct scientific research efficiently, accurately and successfully.

CLASS OUTLINE:

Project presentations as needed.
Students will be given the background information for the transformation lab. We will read over the information together, there will be a short teacher lecture, then students will fill out an application to conduct the lab. Students must “pass” the application in order to participate in the lab procedure later in the week.
See attached documents for background information and application.

HOMEWORK:
To fill out the lab application if we do not complete the task during the class period. Periods are shortened due to an afternoon assembly schedule.

June 6, 2008
Biology, 1st – 4th periods
Mrs. Sabo
FRIDAY

OBJECTIVES:
To apply natural selection and evolution to situations that occur in our environment today.

To understand and apply the idea of natural selection utilizing the 3 different modes of selection that can by at play in the environment

CLASS OUTLINE:

Project presentations for independent experiments, if needed
Collect Take Home Quiz.
Lecture on Darwin and the modes of natural selection that are at play in the environment. (see power-point)
Finish video from Thursday regarding symbiotic relationships in the environment.

HOMEWORK:
Finish Independent experimental project if needed.

June 5, 2008
Biology, 1st – 4th periods
Mrs. Sabo
THURSDAY

OBJECTIVES:
To apply natural selection and evolution to situations that are occurring in our environment today.

CLASS OUTLINE:

Project presentations for independent experiments, if needed

Assign “Evolution in Action” on page 52

Read the Evaluate together in class on page 52.
Read page 54 – Antibiotics together in class, students will take notes of the key information from the reading.
Go over the graph on page 55. Write a short summary showing what the graph means and its implications regarding antibiotics and its use in history/survival rates.
Read “Process & Procedure” on page 53. Complete a paragraph for each of the three scenarios in the book. The more information gathered and recorded, the more information will have to help them on the take home quiz tonight.
Stamp off at the end of the assignment.

HOMEWORK:
Hand out the TAKE HOME QUIZ. It must be typed and submitted at the start of the period tomorrow. NO LATE WORK, or HAND WRITTEN WORK will be accepted. IT IS A QUIZ!

THE EVOLUTIONARY ARMS RACE

Explain how the evolutionary arms race (predator/pray natural selection) is shown in the newt/snake relationship.
Explain how the evolutionary arms race is shown in the bacterial/human relationship.
Explain how T.B. shows mutations for resistance (gel electrophoresis analysis).
Explain in detail the situations that have caused bacterial resistance to antibiotics?
How are we causing organisms to evolve in a way that helps us as humans?
Explain the Feline FIV Virus and it’s evolutionary history in cats.
Explain the HIV disease and how its evolution has caused problems in the fight against it.

June 4, 2008
Biology, 1st – 4th periods
Mrs. Sabo
WEDNESDAY

OBJECTIVES:

Students will understand the “evolutionary arms race” in regards to some examples that are occurring in nature today.

a.   Newt/Snake
b.   Bacteria/Human
c.   TB/Human
d.   FIV/Cats
e. HIV/Humans

CLASS OUTLINE:

Project presentations for independent experiments.

THE EVOLUTIONARY ARMS RACE

Explain how the evolutionary arms race (predator/pray natural selection) is shown in the newt/snake relationship.
Explain how the evolutionary arms race is shown in the bacterial/human relationship.
Explain how T.B. shows mutations for resistance (gel electrophoresis analysis).
Explain in detail the situations that have caused bacterial resistance to antibiotics?
How are we causing organisms to evolve in a way that helps us as humans?
Explain the Feline FIV Virus and it’s evolutionary history in cats.
Explain the HIV disease and how its evolution has caused problems in the fight against it.

June 3, 2008
Biology, 1st – 4th periods
Mrs. Sabo
TUESDAY

OBJECTIVES:

Students will understand predator prey relationships in how it is involved in differential reproductive success in individuals of a species population (camouflage).
Students will recognize that various factors are involved in survival and reproductive success of individuals within a species
Students will use the idea of Natural Selection as a way to explain reproductive success of individuals in regards to

*Predation and Competition for resources such as

Food & water
Mates

Living area/ shelter/ territory

Students will understand the “evolutionary arms race” in regards to some examples that are occurring in nature today.

a.   Newt/Snake
b.   Bacteria/Human
c.   TB/Human
d.   FIV/Cats
e.   HIV/Humans

CLASS OUTLINE:

Project presentations for independent experiments.
Finish Modeling Natural Selection Activity on Pages 47-49 of the textbook by discussion graph homework from last night and finishing questions 2 and 3 from the modeling natural selection segment below.

MODELING NATURAL SELECTION – Analysis Questions

As a team use colored pencils and create a bar graph in your lab notebook to show the number of paper dots of each color in each of the three starting populations, you should have 3 graphs by the time you are finished (one for the first generation, one for the second generation and one for the third generation). You can then compare the graphs to each other to see how the populations color has changed over 3 generations.
Study the bar graphs, consider the following questions, and answer them in your lab notebooks.

Which, if any, colors of paper dots survived better than others in the second and third generations of paper dots?
What might be the reason that predators did not select these colors as much as they did other colors?
What effect did capturing a particular color dot hav on the numbers of that color in the following generations?

Imagine a real life predator/prey relationship and write a paragraph (at least 5 sentences) that describes how one or more characteristics of the predator population or the prey population might change as a result of natural selection (you might have to do some research to answer this completely).
Begin “Evolutionary Arms Race” video/questions.

THE EVOLUTIONARY ARMS RACE

Explain how the evolutionary arms race (predator/pray natural selection) is shown in the newt/snake relationship.
Explain how the evolutionary arms race is shown in the bacterial/human relationship.
Explain how T.B. shows mutations for resistance (gel electrophoresis analysis).
Explain in detail the situations that have caused bacterial resistance to antibiotics?
How are we causing organisms to evolve in a way that helps us as humans?
Explain the Feline FIV Virus and it’s evolutionary history in cats.
Explain the HIV disease and how its evolution has caused problems in the fight against it.

May 30th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
FRIDAY

OBJECTIVES:

Students will be able to articulate and explain the theory of evolution from a historical perspective.
Students will understand who Darwin is and what the theory of natural selection entails.

CLASS OUTLINE:

Project presentations for independent experiments.
Finish Darwin presentation if needed.
Begin Modeling Natural Selection Activity on Pages 47-49 of the textbook.

Processes & Procedures:

Decide who will be the game warden and which team members will be predators.
Examine the paper dots in the starting population count the number of individual dots of each color in generation. Record these in the 1st generation population column in your lab notebook.
Spread the fabric out on the desk top

Hunters will obtain one half of the Petri dish for placing their “kill” in during their hunt. Turn around so that you cannot see the hunting field.
Game warden will spread the dots from the bag labeled Starting population throughout the habitat evenly.

Hunting begins

Game Warden: Direct the predators to fact eh habitat and begin picking up prey (dots). Say “Stop” after 20 seconds of hunting.
Predators: Pick up as many prey (dots) as possible until the game warden says “Stop.”

NOTE: You can only use eyes to pick out prey, you may not FEEL the fabric. You can only use one hand to pick up the dots.

Calculate results of first round of predation.

Predators – Collect the remaining paper dots from the fabric and sort them by color.
Game Warden – Record the number of each color of the remaining paper dots and record this in the END column of the data table for generation 1.

Preparation for generation 2

Together, simulate reproduction among the paper dots by adding three paper dots for each remaining dot of the same color. Obtain these dots from the Petri dishes containing single colors.
Now add the dots to your population and count how many of each color you have and record this in the 2nd generation column.

Repeat steps C through F for round 2 and 3 of predation.
Calculate the number of each color dot remaining at the end. If each colored spot produced 3 offspring, calculate your next generation totals and record this in your lab notebook under 3rd generation end.

As a team, create a bar graph to show how the population has changed through all three generations of hunting and reproducing. Use colored pencils to represent each different color dot on the graph.
Study your bar graph and answer the following questions.

Which, if any, colors of paper dots survived better than others in the second and third starting generations?
What might be the reason that predators did not select these colors as much as they did other colors?
What effect did capturing a particular color have on the numbers of that color in the following generation?

Now clean up by sorting the colored dots into their colors and place 20 of each color dot back into the Petri dish like the one that you were given at the beginning of the activity. The extra dots should go back in the appropriate Petri dish for that color.

HOMEWORK:
Some students still need to finish their independent science project (prelab, postlab, presentation).

May 29th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
THURSDAY

OBJECTIVES:

Students will be able to articulate and explain the theory of evolution from a historical perspective.
Students will understand who Darwin is and what the theory of natural selection entails.

CLASS OUTLINE:

Project presentations for independent experiments.
Review answers to the questions and give short lecture on Darwin and the idea of Natural Selection
Being Modeling Natural Selection activity on pages 47-49 of textbook.

HOMEWORK:
Some students still need to finish their independent science project (prelab, postlab, presentation).

May 28th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
WEDNESDAY

OBJECTIVES:

Students will be able to articulate and explain the theory of evolution from a historical perspective.

CLASS OUTLINE:

Project presentations for independent experiments.
We have shortened periods today due to Cohort Portfolio Grading. Students will finish the reading assignment from yesterday if time permits after presentations - E25-E28 - “Evolution by Natural Selection.”
Students will answer the following questions as they read.

What did Darwin observe about individual members of any species?
How do plant and horse breeders demonstrate “change over time” in their crops?
Explain Mayr’s 5 key points of natural selection and the inferences we draw from them.
What is the difference between selective breeding and natural selection?
How are competition and predation involved in natural selection?

HOMEWORK:
Some students still need to finish their independent science project (prelab, postlab, presentation).

1st period will correct their quizzes from last Thursday (should be done on your own paper and stapled to your quiz. Turn in to me with your quiz tomorrow for added points.

May 27th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
TUESDAY

OBJECTIVES:

Students will be able to articulate and explain the theory of evolution from a historical perspective.

CLASS OUTLINE:

Project presentations for independent experiments.
Students will read E23 “Darwin Proposes Descent with Modification” and E25 “Evolution by Natural Selection.”
Students will answer the following questions as they read.

Who was Charles Darwin? (3 things that you learned about him as a person).
What was the Beagles mission and what did Darwin do on the trip?
What did Darwin discover about geographical distribution of the organisms that he observed?
What does the phrase “descent with modification” mean?
Who is Wallace and why is he important to the theory of evolution?
What did Darwin observe about individual members of any species?
How do plant and horse breeders demonstrate “change over time” in their crops?
Explain Mayr’s 5 key points of natural selection and the inferences we draw from them.
What is the difference between selective breeding and natural selection?
How are competition and predation involved in natural selection?

HOMEWORK:
Some students still need to finish their independent science project (prelab, postlab, presentation).

May 22nd, 2008
Biology, 1st – 4th periods
Mrs. Sabo
THURSDAY

OBJECTIVES: By the end of this activity, students should:

Understand that populations of organisms change across time and that there is scientific evidence to support this idea.
Be able to analyze data and use them as evidence to support an idea.

CLASS OUTLINE:

Students will give their “specialist” presentation within their groups of four.
Quiz will be given on information expressed in the specialist presentations.

HOMEWORK:
Work on independent scientific research project if you still need to complete it.

See attached Word Document on the essay readings of “change over time” if you have missed any class. This is a summary document that explains the main ideas of the essays from each specialty group.

May 20th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
TUESDAY

OBJECTIVES: By the end of this activity, students should:

Understand that populations of organisms change across time and that there is scientific evidence to support this idea.
Be able to analyze data and use them as evidence to support an idea.

CLASS OUTLINE:
Student presentations will be given for independent experimental research project. If time permits we will continue on the JigSaw activity below…. Pg. 38 – 44 in textbook.

Specialists now will return to their original groups to present their evidence to the group. They will create a poster board presentation with all the data from each of the four specialists on it (see rubric).

HOMEWORK:

Work on your research project if you have not completed it. Work on your presentation if you are giving one this week.
If you did not turn in your lab notebook on Friday, I need to get it from you either tonight or tomorrow night for grading.

May 19th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
MONDAY

STUDENT OBJECTIVE:

Students will understand the following ideas (chapter objectives)

That populations of organisms change across time
***That it takes billions f years for the evolutionary process to create the great diversity of life on Earth.
Evidence for biological evolution exists in the fossil record and in biological characteristics such embryological development and genetics
Natural selection is a major mechanism of biological evolution

OBJECTIVES: By the end of this activity, students should:

Understand that populations of organisms change across time and that there is scientific evidence to support this idea.
Be able to analyze data and use them as evidence to support an idea.

CLASS OUTLINE:
Student presentations will be given for independent experimental research project. If time permits we will continue on the JigSaw activity below…. Pg. 38 – 44 in textbook.

Specialists now will return to their original groups to present their evidence to the group. They will create a poster board presentation with all the data from each of the four specialists on it (see rubric).

HOMEWORK:

Work on your research project if you have not completed it. Work on your presentation if you are giving one this week.
If you did not turn in your lab notebook on Friday, I need to get it from you either tonight or tomorrow night for grading.

May 16th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
FRIDAY

STUDENT OBJECTIVE:

Students will understand the following ideas (chapter objectives)

That populations of organisms change across time
***That it takes billions f years for the evolutionary process to create the great diversity of life on Earth.
Evidence for biological evolution exists in the fossil record and in biological characteristics such embryological development and genetics
Natural selection is a major mechanism of biological evolution

OBJECTIVES: By the end of this activity, students should:

Understand that populations of organisms change across time and that there is scientific evidence to support this idea.
Be able to analyze data and use them as evidence to support an idea.

CLASS OUTLINE:
Student presentations will be given for independent experimental research project. If time permits we will continue on the JigSaw activity below…. Pg. 38 – 44 in textbook.

Specialists now will return to their original groups to present their evidence to the group. They will create a poster board presentation with all the data from each of the four specialists on it (see rubric).

HOMEWORK:

Work on your research project if you have not completed it. Work on your presentation if you are giving one this week.

May 15th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
THURSDAY

STUDENT OBJECTIVE:

Students will understand the following ideas (chapter objectives)

That populations of organisms change across time
***That it takes billions f years for the evolutionary process to create the great diversity of life on Earth.
Evidence for biological evolution exists in the fossil record and in biological characteristics such embryological development and genetics
Natural selection is a major mechanism of biological evolution

OBJECTIVES: By the end of this activity, students should:

Understand that populations of organisms change across time and that there is scientific evidence to support this idea.
Be able to analyze data and use them as evidence to support an idea.

CLASS OUTLINE:
Student presentations will be given for independent experimental research project. If time permits we will continue on the JigSaw activity below…. Pg. 38 – 44 in textbook.

Have specialists from each group meet in a different corner to discuss their data.
Specialists will go through their data section in the book and discuss it. They will then answer all questions regarding their information in their lab notebook. They will present their information to their group as well as to the class in their group presentations.
Anthropologists and Embryologists need to study the video representation within their field as well.
Once specialists have gathered all their data, they will return to their original groups to present it to them. They will create a poster board presentation with all the data from each of the four specialists on it. They will then present it to the class at the end of the week.

HOMEWORK:

Work on your research project if you have not completed it. Work on your presentation if you are giving one this week.

May 14th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
WEDNESDAY

STUDENT OBJECTIVE:

Students will understand the following ideas (chapter objectives)

That populations of organisms change across time
***That it takes billions f years for the evolutionary process to create the great diversity of life on Earth.
Evidence for biological evolution exists in the fossil record and in biological characteristics such embryological development and genetics
Natural selection is a major mechanism of biological evolution

OBJECTIVES: By the end of this activity, students should:

Understand that populations of organisms change across time and that there is scientific evidence to support this idea.
Be able to analyze data and use them as evidence to support an idea.

CLASS OUTLINE:
Student presentations will be given for independent experimental research project. If time permits we will continue on the JigSaw activity below…. Pg. 38 – 44 in textbook.

Have specialists from each group meet in a different corner to discuss their data.
Specialists will go through their data section in the book and discuss it. They will then answer all questions regarding their information in their lab notebook. They will present their information to their group as well as to the class in their group presentations.
Anthropologists and Embryologists need to study the video representation within their field as well.
Once specialists have gathered all their data, they will return to their original groups to present it to them. They will create a poster board presentation with all the data from each of the four specialists on it. They will then present it to the class at the end of the week.

HOMEWORK:

Work on your research project if you have not completed it. Work on your presentation if you are giving one this week.

May 12th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
MONDAY

STUDENT OBJECTIVE:

Students will understand the following ideas (chapter objectives)

That populations of organisms change across time
***That it takes billions f years for the evolutionary process to create the great diversity of life on Earth.
Evidence for biological evolution exists in the fossil record and in biological characteristics such embryological development and genetics
Natural selection is a major mechanism of biological evolution

Today’s Objectives:

Students will understand how scientists use evidence to create inferences.
Students will understand the history of the Earth based on geological evidence.

CLASS OUTLINE:
Activity: Modeling the Earth’s History - pg. 36 – 38

Students will answer Analysis questions on page 37-38 #1-3 after analysis of their time line with their group. Assignment will be stamped upon completion.

ASSIGNMENT:
Use the time line that you just created to answer the following questions with your team mates. Record your answers in your journal.

Describe 5 patterns that you see in the time line. For example, describe a relationship between geological and biological events or a relationship between plant and animal events.

Most events are near the present where only a few are in “deep time” on the time line. Also, plant event preceed animal events (animals didn’t come onto land until plants had established themselves). Also, organisms didn’t come onto land at all until the O2 levels rose in the air.

Is it likely that these patterns occurred separately or do you think they might be related? Explain your reasoning by using 1 or 2 of your examples above.

Remember that the Fossil Record is incomplete and we do not have all of the evidence for every major biological event because the earth’s crust recycles itself and most of the evidence is lost during this process.

What did the time line (a model) help you understand about the earth’s history?

You should be able to describe something you learned during this activity such as the immensity of the time scale for earth’s history or the relative rapidity with which recent biological events occurred.

**3 presentations will be given in class for independent research projects.

JIGSAW ACTIVITY:
(this activity will begin either Monday or Tuesday and proceed through the remainder of the week)

OBJECTIVES: By the end of this activity, students should:

Understand that populations of organisms change across time and that there is scientific evidence to support this idea.
Be able to analyze data and use them as evidence to support an idea.

CLASS OUTLINE:

Put teams together (groups of 4)
Assign each member a specialist role

Paleo-geologist
Evolutionary Biologist
Embryologist
Physical Anthropologist

Have specialists from each group meet in a different corner to discuss their data.
Specialists will go through their data section in the book and discuss it. They will then answer all questions regarding their information in their lab notebook. They will present their information to their group as well as to the class in their group presentations.
Anthropologists and Embryologists need to study the video representation within their field as well.
Once specialists have gathered all their data, they will return to their original groups to present it to them. They will create a poster board presentation with all the data from each of the four specialists on it. They will then present it to the class at the end of the week.

HOMEWORK:

Work on your research project if you have not completed it. Work on your presentation if you are giving one this week.

May 9th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
FRIDAY

STUDENT OBJECTIVE:

Students will understand the following ideas (chapter objectives)

That populations of organisms change across time
***That it takes billions f years for the evolutionary process to create the great diversity of life on Earth.
Evidence for biological evolution exists in the fossil record and in biological characteristics such embryological development and genetics
Natural selection is a major mechanism of biological evolution

Today’s Objectives:

Students will understand how scientists use evidence to create inferences.
Students will understand the history of the Earth based on geological evidence.

CLASS OUTLINE:
Activity: Modeling the Earth’s History - pg. 36 – 38

Students are given a handout that shows the major geological and biological events that have occurred during earth’s history. Students will create a time line in their group of 4 that will show Geological events in one color and Biological events in another color to show not only when events happened, but how they may/may not be related to each other.

After completion of the time line, students will answer Analysis questions on page 37-38 #1-3.

ASSIGNMENT:
Use the time line that you just created to answer the following questions with your team mates. Record your answers in your journal.

Describe 5 patterns that you see in the time line. For example, describe a relationship between geological and biological events or a relationship between plant and animal events.
Is it likely that these patterns occurred separately or do you think they might be related? Explain your reasoning by using 1 or 2 of your examples above.
What did the time line (a model) help you understand about the earth’s history?

HOMEWORK:

Work on your independent research project (if not finished and turned in to me today).
Work on your presentation (for those who have signed up for presentation times today).
Finish above questions 1-3 if you have not done so already.

May 8th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
THURSDAY

STUDENT OBJECTIVE:

Students will understand the following ideas (chapter objectives)

That populations of organisms change across time
***That it takes billions f years for the evolutionary process to create the great diversity of life on Earth.
Evidence for biological evolution exists in the fossil record and in biological characteristics such embryological development and genetics
Natural selection is a major mechanism of biological evolution

Today’s Objectives:

Students will understand how scientists use evidence to create inferences.
***Students will understand the history of the Earth based on geological evidence.

CLASS OUTLINE:

Teacher/Student discussion on

How might Lucy bridge the gap between modern humans and early nonhuman primates?

Class will discuss ideas that they have regarding this piece of fossil evidence and its significance is showing where we came from.
Students will answer questions 1 and 2 analysis on page 35 with their partners in their lab notebook. We will then discuss the information they have written down as a class discussion.

Compare hominids form Lucy’s time to that of today. Do you think there have been changes in physical characteristics of the body (hands, feet, head, posture), do you think there are changes in how they lived (shelters, ways of getting around, ways of gathering food)?
After reading the paragraph in the book answer the following questions:

What aspects of your description are based on evidence?
Which aspects of your description were inferences related to the evidence and why do you say this?
Which aspects of your description were guesses?

Students will begin the “time-line” activity on page 36 and 37 of the text book to gain information on the history of the Earth.

HOMEWORK:
PROJECT POSTLAB DUE ON TOMORROW.
PROJECT SIGN UP FOR VISUAL PRESENTATIONS TOMORROW.
Presentations will be given next week as needed.

May 5th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
MONDAY

STUDENT OBJECTIVE:

Students will gain understanding of other modes of inheritance besides basic dominant and recessive gene alleles.
Students will gain understanding of karyotypes, how they are used as well as how they are made.
Students will understand how to determine male vs. female as well as normal vs abnormal results.

CLASS OUTLINE:

Brief overview of the “Modes of Inheritance” 6 traits.
Short lecture on Karyotypes (male vs. female, disordered vs. normal)
Work on review sheet, review period with me for exam information.

HOMEWORK:

To work on their independent research project, final is due on May 9th (FRIDAY).
Work on review sheet, exam tomorrow.

May 2nd, 2008
Biology, 1st – 4th periods
Mrs. Sabo
FRIDAY

STUDENT OBJECTIVE:

Students will gain understanding of other modes of inheritance besides basic dominant and recessive gene alleles.

CLASS OUTLINE:

Review of lecture on other Modes of Inheritance. Please be aware that more than one of these modes of inheritance can be at work at any one time.

Complete dominance – normal dominant and recessive where the dominant allele will completely cover the recessive allele trait if they are present in the heterozygous form. The only way to express a recessive is to have homozygous recessive phenotype.
Co-dominance – when there are more than one gene allele that is expressed whenever it is present. An example of this is ROAN CATTLE. In cattle, red and white hair are both dominant alleles. Therefore if you get the red allele and the white gene allele for this gene (heterozygous) you will have both red and white hair intermixed together.

Cross a homozygous red hair with a homozygous white hair and you will get a heterozygous R&W hair. R R x r r = R r (roan), or you could do it with different letters if the “r” confuses you with recessive traits. R R x W W = R W (co-dominant, both expressed)

Incomplete Dominance – When the dominant is “sort – of” dominant over the recessive. Although the dominant does cover the recessive, a small amount of the recessive shows through, giving a BLENDING of traits.
Multiple Alleles – when there are not just 2 forms of the gene. In other words you can’t just use B b to express the trait because there are more than 2 different types so you would need 3 letters to express it, or maybe even 4, depending on how many variations of the gene there are.
Pleiotripic – This occurs when a single gene influences multiple phenotypic traits. Consequently, a new mutation in the gene will have an effect on all traits simultaneously.
Polygenic – when more than one gene effects a single trait. In other words you can have a mutation in different parts of your DNA (perhaps even on different chromosomes) and it can effect the same part of your body. An example would be eye color. There are several gene products that work together, thus there are several proteins that are released that give the color to your eye, the color of your skin, or height in humans.

Students will complete an assignment where they are given 6 different “TRAITS” and they have to figure out what type of modes of inheritance are at play and their reasoning behind their ideas.

HOMEWORK:

To work on their independent research project.
Work on review sheet, exam on Tuesday

May 1st, 2008
Biology, 1st – 4th periods
Mrs. Sabo
THURSDAY

STUDENT OBJECTIVE:
Students will gain understanding of other modes of inheritance besides basic dominant and recessive gene alleles.

CLASS OUTLINE:

Two practice problems done by students on X-linked and linked traits from yesterdays class discussion.
Discussion of the practice problems plus any additional questions that students have regarding linked or X-linked traits at this point.
Lecture on other Modes of Inheritance. Please be aware that more than one of these modes of inheritance can be at work at any one time.

Complete dominance – normal dominant and recessive where the dominant allele will completely cover the recessive allele trait if they are present in the heterozygous form. The only way to express a recessive is to have homozygous recessive phenotype.
Co-dominance – when there are more than one gene allele that is expressed whenever it is present. An example of this is ROAN CATTLE. In cattle, red and white hair are both dominant alleles. Therefore if you get the red allele and the white gene allele for this gene (heterozygous) you will have both red and white hair intermixed together.

Cross a homozygous red hair with a homozygous white hair and you will get a heterozygous R&W hair. R R x r r = R r (roan), or you could do it with different letters if the “r” confuses you with recessive traits. R R x W W = R W (co-dominant, both expressed)

Incomplete Dominance – When the dominant is “sort – of” dominant over the recessive. Although the dominant does cover the recessive, a small amount of the recessive shows through, giving a BLENDING of traits.
Multiple Alleles – when there are not just 2 forms of the gene. In other words you can’t just use B b to express the trait because there are more than 2 different types so you would need 3 letters to express it, or maybe even 4, depending on how many variations of the gene there are.
Pleiotripic – This occurs when a single gene influences multiple phenotypic traits. Consequently, a new mutation in the gene will have an effect on all traits simultaneously.
Polygenic – when more than one gene effects a single trait. In other words you can have a mutation in different parts of your DNA (perhaps even on different chromosomes) and it can effect the same part of your body. An example would be eye color. There are several gene products that work together, thus there are several proteins that are released that give the color to your eye, the color of your skin, or height in humans.

Students will complete an assignment where they are given 6 different “TRAITS” and they have to figure out what type of modes of inheritance are at play and their reasoning behind their ideas.

HOMEWORK:

To work on their independent research project.
Work on review sheet, exam on Tuesday

April 30th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
WEDNESDAY

OBJECTIVE::
Students will be able to explain how alleles on the same chromosome display different expression patterns in the offspring (linkage and X-linked will be explored)

CLASS OUTLINE:

Finish up part B of “Can you sort it out” from the text book pages 244-247.
Part C and D will be explored with partner regarding linked and X-linked traits.
Students will then work on review sheet as time permits.

HOMEWORK:

To work on their independent research project.
Work on review sheet, exam on Friday

April 29th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
TUESDAY

OBJECTIVE:: Students will gain additional knowledge regarding meiosis, independent assortment, and the role of variation (mutations) in evolution of a species.

CLASS OUTLINE:

Students will read pages E160-E168 of the text book (I have placed these on the desks and 3rd period will need to put them back neatly on the bookshelf by the door before they leave). 4th period will get textbooks out of the cabinet in room 409, they know where they are, and they should put them back in the cabinet before they may leave.
After reading pages E160-E168 they will take cornel notes on the reading. This should be at least one full page of notes (stamp at the end of their notes), plus 3 additional questions that they still have regarding the material (stamp at the end of their 3 questions too).
Lastly, students will turn to page 247 of the text book and answer questions 1 and 2 of the analysis, in complete sentences, in their lab book. Stamp at the end of question #2 when they have finished.

NOTE: They should not have to work in groups to do this assignment.

HOMEWORK: To work on their independent research project.

April 28th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
MONDAY

STUDENT OBJECTIVE:
Today’s objectives are:

Students will continue work with Punnett squares with Mono-hybrid and Di-hybrid crosses to find P1 offspring in the F1 and F2 generations. Phenotype and genotype ratios will be calculated.

CLASS OUTLINE:

Stamp and review worksheet questions 1-5.
Students will then complete the dihybrid questions on the worksheet (6-10). We will go over how to complete the questions at the end of the period if time allows.

HOMEWORK
Work on individual experimental research project. Due date is May 9th for Data, Graph, Discussion/Analysis and Conclusion. Projects will be presented May12th through 16th.
**Finish Punnett Square worksheet if not completed 1-10 by the end of the period.

April 24th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
Thursday

STUDENT OBJECTIVE:
Today’s objectives are:

Students will create and utilize punnet squares to show how different gene found in gametes are independently distributed to the offspring in genetic crosses, such as those that Gregory Mendel performed with Garden Peas.
Students will apply their punnet square results to determine phenotype and genotype ratio of offspring from several matings.
Students will be able to predict phenotype and genotype outcomes after a parent generation (P1) is mated to create the offspring (F1) or perhaps grandchildren (F2).

CLASS OUTLINE:

Students will finish work on Part A of “Can you sort it out,” by finishing the video disc segment and questions in their lab notebooks on monohybrid crosses.
Students will then go through the CAN YOU SORT IT OUT Part B: Two Mendelian Traits: Pea Pod Color and Shape and complete steps 1-5 on pages 244-245 of text. Practice genetic problems on monohybrid cross by completing worksheet and attaching it in lab notebook.

HOMEWORK
FINISH WORKSHEET AND ATTACH IN LAB NOTEBOOK IF NOT COMPLETED IN CLASS.

Work on individual experimental research project. Due date is May 9th for Data, Graph, Discussion/Analysis and Conclusion. Projects will be presented May12th through 16th.

April 23rd, 2008
Biology, 1st – 4th periods
Mrs. Sabo
Wednesday

STUDENT OBJECTIVE:
Today’s objectives are:

Students will create and utilize punnet squares to show how different gene found in gametes are independently distributed to the offspring in genetic crosses, such as those that Gregory Mendel performed with Garden Peas.
Students will apply their punnet square results to determine phenotype and genotype ratio of offspring from several matings.
Students will be able to predict phenotype and genotype outcomes after a parent generation (P1) is mated to create the offspring (F1) or perhaps grandchildren (F2).

CLASS OUTLINE:

Students will finish yarn activity with meiosis and explain 3 ways in which mitosis and meiosis are similar and 3 ways in which they are different.
Some classes will watch a short video clip on how meiosis work.
Students will then watch the video segment on Mendel’s peas to work through some monohybrid (one trait) cross and answer video questions.
Students will then go through the CAN YOU SORT IT OUT Part B: Two Mendelian Traits: Pea Pod Color and Shape.

HOMEWORK:
Work on individual experimental research project. Due date is May 9th for Data, Graph, Discussion/Analysis and Conclusion. Projects will be presented May12th through 16th.

April 21st, 2008
Biology, 1st – 4th periods
Mrs. Sabo
Monday

STUDENT OBJECTIVE:
Today’s Objective:

Students will be able to visualize the relationship between traits and genetic information present in an organism.
Students should be aware that genetic information comes in different forms (alleles) and that these forms can separate and combine.
Students should understand the concepts of heterozygous, homozygous, dominant and recessive.

CLASS OUTLINE:

Complete Process and Procedures page 238, Part B: Inheritance of TWO Traits.

Now read E155 – E158 and define the terms below as you read. When you are finished with the reading and defining the terms, come up with 3 additional questions that you have about the genetics that you have learned so far.
After reading the section, define the following terms in your lab notebook using your own words.

Phenotype
Genotype
Chromosomes
Gene
Alleles
Gametes
Traits
Heterozygous
Homozygous
Dominant trait
Recessive trait
Independent assortment

Short lecture from the reading will be given. Then you need to read the information on pages E158-E160 (green pages) and answer the analysis questions on page 240 of the text book (#1-4 only).

HOMEWORK:
*Work on your independent research project.
*Your next due date is Friday. At this time I will check to see if you have some “data” entered in your lab notebook regarding your experiment. You should be progressing on carrying out your experiment (at least ½ way through at this point).
*IMPORTANT CHANGE – Due date for final data, graph, analysis/discussion, conclusion will be 9th. Presentations will be given May 12th – 16th as needed.

Finish the analysis questions if you have not already done so. Questions 1-4 below.

Although Huntington disease is a dominant trait, symptoms do not appear until late adult years. What are the implications for young adult children of a parent who has Huntington disease?
Restate the following statement to make it more accurate. One out of every two offspring resulting from a cross between parents with the genotypes Hh and hh definitely will have Huntington disease.
Two healthy individuals marry and produce three children. The first two are healthy, but the third is born with cystic fibrosis, indicating that she is homozygous cc for the cystic fibrosis alleles. What can you conclude about the genotype of the other people in the family? In other words, what is the genotype (who alleles carried) by each of the following people – Mom, Dad, Sister 1, Brother 1, affected daughter. You can create a pedigree to show this if it is easier for you.
What is the probability for the couple in question 3 that their future children will have cystic fibrosis? What are the implications for their healthy children?

April 18th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
Friday

STUDENT OBJECTIVE:
Today’s Objective:

Students will be able to visualize the relationship between traits and genetic information present in an organism.
Students should be aware that genetic information comes in different forms (alleles) and that these forms can separate and combine.
Students should understand the concepts of heterozygous, homozygous, dominant and recessive.

CLASS OUTLINE:

Read and discuss information from page 237 regarding parental characteristics and how they compare to the characteristics of their offspring.
Complete Process and Procedures page 238, Part A: Inheritance of One Trait.

Select two beans randomly from the container that your teacher provides
Record in your journal what color your beans are (2 brown, 2 whites, one brown and one white)
If the beans are the same color they are “homozygous.” If you have one of each color, they are “heterozygous.” The term “homo” means the same and “hetero” means different.
Shake the beans in your hands and randomly pick one of the beans out. Set the other bean aside. Since each parent randomly contributes one of their “alleles” to their offspring, you have just determined which of your alleles for the straight vs. floppy ear gene that you are going to give to your offspring. Parents do not know which “allele” they will contribute until after the child is born and they see what traits or “phenotype” the child possesses.
Combine your gene and your partners gene together and record the “genotype” of your offspring (2 browns, 2 whites, or one of each; Homozygous brown, homozygous white, or heterozygous). This is the GENOTYPE of your child.
Brown, Brown = homozygous brown = straight ears

Brown, White = heterozygous = straight ears
White, White = homozygous white = floppy ears

When you first chose your bean colors from the jar representing your genotype, what genotype were you and what phenotype or characteristics did you possess?
What genotype and phenotype did your partner possess?
What genotype and phenotype did your child possess?
Did one bean color (gene) have a greater influence in determining the ear trait than the other? Explain why or why not using the terms dominant and recessive.
Now read E155 – E158 and take cornel notes on the reading. At least one page of notes and 3 additional questions that you have. We will continue this on Monday if time does not permit us to finish the essay assignment.

HOMEWORK:
*Work on your independent research project.
- your next due date is Friday. At this time I will check to see if you have some “data” entered in your lab notebook regarding your experiment. You should be progressing on carrying out your experiment (at least ½ way through at this point). Your filled out data tables, discussion/analysis and conclusion sections are due on May 2nd. Your presentations (must be visual with pictures showing YOU carrying out your experiment) will be given over the week of May 5th through May 9th. Sign ups for your time slot will be given on May 2nd. Presentations cannot be more than 10 minutes long.

April 17th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
Thursday

STUDENT OBJECTIVE:
Today’s Objective:

Students will be able to explain why predicted and actual results may differ in the flipping of coins and in genetic crosses.
Students will be able to state the importance of sample size with regards to how well actual results match up with predictions that are based on probability.
Students will be able to evaluate a mock medical study that relies on a small sample size.

---- We may begin the next activity if time….
Those objectives are as follows:

Students will be able to visualize the relationship between traits and genetic information present in an organism.
Students should be aware that genetic information comes in different forms (alleles) and that these forms can separate and combine.
Students should understand the concepts of heterozygous, homozygous, dominant and recessive.

CLASS OUTLINE:

Students will finish steps 3-6 of the game of chance on pages 230 – 234 of the textbook.
Class data will be collected and percentages of males and females will be calculated and discussed as a class.
Analysis questions 1-2 on page 233 will be completed for assessment of understanding.
Patterns of inheritance on page 237 – 240 of the textbook will begin if time allows. Activity will be continued in class on Friday.
DO NOT FORGET THAT FORMAL PRELAB FOR INDEPENDENT RESEARCH, EXPERIMENT PROJECT IS DUE TOMORROW.

HOMEWORK:
*Work on your independent research project.
*work on data tables and conducting experiment.
*Next due date for project is your Formal Final Draft of your PRELAB which is due this FRIDAY, April 18th. This should include all of the following parts
1. TITLE
2. PURPOSE STATEMENT
Fundamental Question and Testable Question (M.V and R.V clearly stated)
3. BACKGROUND with WORK CITED (MLA format)
5. PROTOCOL
Materials and Procedures
6. DATA TABLES (do not have to be filled in at this point)

April 16th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
Wednesday

STUDENT OBJECTIVE:
Unit Objectives: Students will be able to understand the following:

Understand that continuity of a species depends on genetic transfer of information.
Understand the differences between Genotype and Phenotype and how genotype leads to the phenotype of the organism
Genetics plays a role in physical and biochemical characteristics, as well as complex traits such as intelligence and behavior.

Today’s Objective:

Students will be able to explain why predicted and actual results may differ in the flipping of coins and in genetic crosses.
Students will be able to state the importance of sample size with regards to how well actual results match up with predictions that are based on probability.
Students will be able to evaluate a mock medical study that relies on a small sample size.

CLASS OUTLINE:

Students will finish discussion of some basic traits and how common they are in the class population. Discussion of dominance and recessive will continue.
Students will begin “Game of chance” activity to investigate probability and sample size. Activity is found on pages 230-233 in textbook.

April 15th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
Tuesday

STUDENT OBJECTIVE:
Unit Objectives: Students will be able to understand the following:

Understand that continuity of a species depends on genetic transfer of information.
Understand the differences between Genotype and Phenotype and how genotype leads to the phenotype of the organism
Genetics plays a role in physical and biochemical characteristics, as well as complex traits such as intelligence and behavior.

Today’s Objective:

Students will be able to explain why predicted and actual results may differ in the flipping of coins and in genetic crosses.
Students will be able to state the importance of sample size with regards to how well actual results match up with predictions that are based on probability.
Students will be able to evaluate a mock medical study that relies on a small sample size.

CLASS OUTLINE:

Students will finish discussion of detemental traits by finishing discussion of questions from yesterday’s class.
Classic Mendelian traits will be discussed and noted in lab notebook as to whether each student possesses it or not. These traits are shared by many of us and are not considered to be “abnormalities” such as the hemophilia trait read about in the story.

Cleft chin – presence of a dimple in the chin
Bent pinky syndrome – the presence of a digit or digits that bend noticeably toward the other fingers.
Mid-digital hair – the presence of hair on the middle section of a finger.
Dimples
Short Hallux – the big toe is shorter than the toe next to it.
Short Index Finger – Index finger is shorter than your ring finger.
Tongue roller
Widows Peak
Free or attached ear lobes (more complex trait)
Hitchhikers thumb

Students will begin “Game of chance” activity to investigate probability and sample size. Activity is found on pages 230-233 in textbook.

April 14th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
Monday

STUDENT OBJECTIVE:
Unit Objectives: Students will be able to understand the following:

Understand that continuity of a species depends on genetic transfer of information.
Understand the differences between Genotype and Phenotype and how genotype leads to the phenotype of the organism
Genetics plays a role in both physical and biochemical characteristics, as well as complex traits such as intelligence and behavior.

Week objectives:

Students will become aware that some traits are inherited and can be traced in family lineage, that inherited traits are not necessarily expressed at each generation, and that traits can be acquired or can be genetically determined.

CLASS OUTLINE:

Brief review of the video from Friday before break. Explain the genetics of the gene that caused some people to die, others to get sick and survive, and yet others to never get the disease and it’s relationship to HIV immunity today.
Read introduction to chapter on page 229 as a class.
Read the story on page 231 and answer question #2 on page 230 (abcd) with your table partner, in your lab notebook. A short discussion of your ideas will follow.
Classic Mendelian traits will be discussed and noted in lab notebook as to whether each student possesses it or not. These traits are shared by many of us and are not considered to be “abnormalities” such as the hemophilia trait read about in the story.

Cleft chin – presence of a dimple in the chin
Bent pinky syndrome – the presence of a digit or digits that bend noticeably toward the other fingers.
Mid-digital hair – the presence of hair on the middle section of a finger.
Dimples
Short Hallux – the big toe is shorter than the toe next to it.
Short Index Finger – Index finger is shorter than your ring finger.
Tongue roller
Widows Peak
Free or attached ear lobes (more complex trait)
Hitchhikers thumb

What is the difference between acquired traits and inherited traits? Discuss why some traits you get over your life time and others you are born with.

HOMEWORK:
*Work on your independent research project.
*work on data tables and conducting experiment.
*Next due date for project is your Formal Final Draft of your PRELAB which is due on April 18th. This should include all of the following parts
1. TITLE
2. PURPOSE STATEMENT
Fundamental Question and Testable Question (M.V and R.V clearly stated)
3. BACKGROUND with WORK CITED (MLA format)
5. PROTOCOL
Materials and Procedures
6. DATA TABLES (do not have to be filled in at this point)

April 4th, 2008
Biology, 1st – 4th periods
Mrs. Sabo
Friday

STUDENT OBJECTIVE:
*Students will understand a specific example of how the history of infectious diseases is now being better understood by the implementation of genetic techniques to uncover the mystery of the black plaque.

*Students will also see how this history or immunity is still at work today in fighting HIV infections.

CLASS OUTLINE:

Begin Genetics – “Secrets of the Dead – Mystery of the Black Death”

Geneticist Stephen O’Brien delves into the reasons why some individuals managed to survive the excruciating Black Death wile others were dying around them. Video shows life at the height of an epidemic and how genetics is being used to conduct a case study that uncovers previously unknown elements of why some people survived and others did not – and the mysterious link to HIV immunity in today’s populations due to these same genetics.

HOMEWORK:
*Work on your independent research project.
*work on data tables and conducting experiment.
*Next due date for project is your Formal Final Draft of your PRELAB which is due on April 18th. This should include all of the following parts
1. TITLE
2. PURPOSE STATEMENT
Fundamental Question and Testable Question (M.V and R.V clearly stated)
3. BACKGROUND with WORK CITED (MLA format)
5. PROTOCOL
Materials and Procedures
6. DATA TABLES (do not have to be filled in at this point)

April 3rd, 2008
Biology, 1st – 4th periods
Mrs. Sabo
Thursday

STUDENT OBJECTIVE:
Students will be able to:
Understand why the cell needs to replicate
Understand what cell parts are utilized to make replication successful
Understand key events in each of the stages of the cell cycle
Understand what problems arise when this process is disrupted

CLASS OUTLINE:

Collect late elephant labs or lab notebooks from 3rd and 4th who were absent on Monday.
Quiz on the cell cycle – the cell cycle book you made yesterday can be used on the quiz
Turn in cell cycle books and record/correct quizzes
Begin Genetics – “Secrets of the Dead – Mystery of the Black Death”

Geneticist Stephen O’Brien delves into the reasons why some individuals managed to survive the excruciating Black Death wile others were dying around them. Video shows life at the height of an epidemic and how genetics is being used to conduct a case study that uncovers previously unknown elements of why some people survived and others did not – and the mysterious link to HIV immunity in today’s populations due to these same genetics.

HOMEWORK:
*Work on your independent research project.
*work on data tables and conducting experiment.
*Next due date for project is your Formal Final Draft of your PRELAB which is due on April 18th. This should include all of the following parts
1. TITLE
2. PURPOSE STATEMENT
Fundamental Question and Testable Question (M.V and R.V clearly stated)
3. BACKGROUND with WORK CITED (MLA format)
5. PROTOCOL
Materials and Procedures
6. DATA TABLES (do not have to be filled in at this point)

April 2nd, 2008
Biology, 1st – 4th periods
Mrs. Sabo
Wednesday

STUDENT OBJECTIVE:
Students will be able to:
            Understand why the cell needs to replicate
            Understand what cell parts are utilized to make replication successful
            Understand key events in each of the stages of the cell cycle
            Understand what problems arise when this process is disrupted

CLASS OUTLINE:

Collect late elephant labs or lab notebooks from 3rd and 4th who were absent on Monday.
Students will make a cell cycle book.

The book will consist of 3 chapters

Interphase
Mitosis
Cytokenesis

Students will include a LABELED DRAWING on each page that symbolizes each event that occurs during that stage. The parts that are included in the cell picture must be labeled and a description of each stage must be written in words.
You can use your notes from yesterday (make sure these get attached in your lab notebook before you leave today), or page 196 in the textbook.
Cell cycle book will be worked on in class today. Must be finished at home tonight if you do not finish it in class. There will be a quiz on the cell cycle tomorrow.

HOMEWORK:
*** FINISH CELL CYCLE BOOK IF YOU DID NOT DO SO IN CLASS.

*Work on your independent research project.
*work on data tables and conducting experiment.
*Next due date for project is your Formal Final Draft of your PRELAB which is due on April 18th. This should include all of the following parts
1. TITLE
2. PURPOSE STATEMENT
Fundamental Question and Testable Question (M.V and R.V clearly stated)
3. BACKGROUND with WORK CITED (MLA format)
5. PROTOCOL
Materials and Procedures
6. DATA TABLES (do not have to be filled in at this point)

LECTURE INFORMATION – Finished from Tuesday:
Why do cells reproduce?
1. To replace themselves*
            2. Cells have a limited life span / number of replications
            3. In order for growth of the organism*
            4. To repair damage*
            5. To create new structure (development)
            6. To make themselves smaller so that they can feed their volume efficiently.
What happens if this process is disrupted.

Damage cannot be repaired (death)
Growth of the organism slows / stops
Development cannot occur (death)
Cells reproduce out of control (cancer)

What cell parts are involved during replication?
            Centrioles
            DNA (chromatin – chromosomes – sister chromatids)
            Centromeres
            Nucleus
            Spindle Fibers
            Cytoplasm
            (All organelles)
What occurs at each stage?
            CELL CYCLE – THE CELLS LIFE – Told in Three (3) chapters
                        INTERPHASE – 90% of the cells life

Time of growth / metabolic activity
Cell eats, releases waste, grows, repairs damage, etc
Copies its DNA
Makes more organelles

                        MITOSIS
                                    a. Prophase
                                                1. Chromatin ravels up, becomes chromosomes
                                                2. Sister Chromatids connected at centromere
                                                3. Nucleus disappearing
                                                4. Centrioles migrate to poles
                                    b. Metaphase
                                                1. Spindle fibers are made and connect to chromosomes
                                                2. Chromosomes lined up in middle with sister chromatid
                                                3. Centrioles at opposite sides of the cell (poles)
                                    c. Anaphase
                                                1. Centrioles shorten spindle fibers and pull sister
chromatids apart
                                                2. Sister chromatids pulled apart to separate centromere
                                    d. Telophase
                                                1. Spindle fibers have disappeared
                                                2. Nucleus reforms, Chromosomes begin to unwind
                                                3. Cell membrane pinches inward in middle.
CYTOKENISIS – Two new cells are formed.

Cytoplasm pinches together creating 2 new cells.
Cytoplasm and organelles are distributed equally in 2 new cells
Nucleus has reformed.
Chromosomes not visible, chromatin present.

April 1st, 2008
Biology, 1st – 4th periods
Mrs. Sabo
Tuesday

CLASS OUTLINE:

Short Lecture on Mitosis (see information below)

See lecture information below
Students will also be given hand-out with additional information on it

Students will make a cell cycle book.

The book will consist of 3 chapters

Interphase
Mitosis
Cytokenesis

Students will include a LABELED DRAWING on each page that symbolizes that events that occur during that stage. The parts that are included in the cell picture must be labeled and a description of each stage must be written in words.
Cell cycle book will be started in class today, work on it tomorrow as well.

1. TITLE
2. PURPOSE STATEMENT
a. Fundamental Question
b. Testable Question (make sure manipulated and responding variables are clearly stated.
3. BACKGROUND: Information should explain how it is related to your lab)
4. WORK CITED, MLA Format
5. PROTOCOL

Materials
Procedures

6. DATA TABLES (do not have to be filled in at this point)

LECTURE INFORMATION:
Why do cells reproduce?
1. To replace themselves*
2. Cells have a limited life span / number of replications
3. In order for growth of the organism*
4. To repair damage*
5. To create new structure (development)
6. To make themselves smaller so that they can feed their volume efficiently.
What happens if this process is disrupted.

Damage cannot be repaired (death)
Growth of the organism slows / stops
Development cannot occur (death)
Cells reproduce out of control (cancer)

What cell parts are involved during replication?
Centrioles
DNA (chromatin – chromosomes – sister chromatids)
Centromeres
Nucleus
Spindle Fibers
Cytoplasm
(All organelles)
What occurs at each stage?
CELL CYCLE – THE CELLS LIFE – Told in Three (3) chapters
INTERPHASE – 90% of the cells life

Time of growth / metabolic activity
Cell eats, releases waste, grows, repairs damage, etc
Copies its DNA
Makes more organelles

Cytoplasm pinches together creating 2 new cells.
Cytoplasm and organelles are distributed equally in 2 new cells
Nucleus has reformed.
Chromosomes not visible, chromatin present.

March 31st 2008
Biology, 1st – 4th periods
Mrs. Sabo
Monday

STUDENT OBJECTIVE:
Students will be able to:
            Understand why the cell needs to replicate
            Understand what cell parts are utilized to make replication successful
            Understand key events in each of the stages of the cell cycle
            Understand what problems arise when this process is disrupted

CLASS OUTLINE:

Stamp off rough draft of pre-lab in the lab notebook.
Remind students to begin their experimental process “NOW” so that they have enough time to complete the work by May 2nd (FORMAL DUE DATE).
Hand out project due date reminder sheet and presentation grading rubric.
Self grading of lab notebook for assignments that are currently present.
Read and do cornel notes on pages E195-E198 of the textbook. Students need at least a full page of notes and 3 additional questions you have regarding the process.

HOMEWORK:
*Work on your independent research project.
*work on data tables and conducting experiment.

March 28th 2008
Biology, 1st – 4th periods
Mrs. Sabo
Friday

STUDENT OBJECTIVE:
Students will be able to:

Students will gain understanding of protein synthesis, transcription and translation.
Students will understand what parts of the cell are involved in protein synthesis.
Students will be able to construct proteins using the genetic code/decoding process.

CLASS OUTLINE:

Students will finish their poster presentations
A quiz will be given over their knowledge of protein synthesis (transcription/translation).

HOMEWORK:
Work on your independent research project.
Rough draft of your Pre-Lab is due on Monday in your lab notebook.
Rough draft includes all of the following
            Purpose Statement (fundamental and testable question)
            Background (at least 3 paragraphs)
            Work Cited (at least 5 sources, 2 must be print)
            Hypothesis (If, then, because statement)
            Protocol (materials and procedure)

March 27th 2008
Biology, 1st – 4th periods
Mrs. Sabo
Thursday

STUDENT OBJECTIVE:
Students will be able to:
Have time to work on their independent research projects.
Show their understanding of the scientific process and set up a testable question, hypothesis, gather background and create a procedure to test their question.

CLASS OUTLINE:

Students will have the class period in the library to work on their background/work cited as well as their procedure part of the prelab.
Rough draft of the pre-lab is due in the lab notebook on Monday.
Quiz over protein synthesis tomorrow.
Finish project presentations tomorrow in class.

HOMEWORK:
*Study… there will be a short in class quiz on transcription/translation and the cell parts involved tomorrow.

*Complete your “PRE-LAB” for your independent research project in your lab notebook. The following parts should be present.
            Purpose statement:
                        Fundamental and Testable questions
            Background information: At least 3 paragraphs at this point.
Should be at least 5 paragraphs by the final draft.
            Work Cited: 5 sources where at least 2 of them are “print.”
            Hypothesis: Must be in the If… then…. Because…. Format.
            Protocol: Must have procedure steps and materials listed.

**Next thing to think about will be your data tables, and remember you must have numerical data collected for your project and be able to GRAPH the data to explain it in your presentation.

March 26th 2008
Biology, 1st – 4th periods
Mrs. Sabo
Wednesday

STUDENT OBJECTIVE:
Students will be able to:

Students will gain understanding of protein synthesis, transcription and translation.
Students will understand what parts of the cell are involved in protein synthesis.
Students will be able to construct proteins using the genetic code/decoding process.
Show progress on their independent research project by completing homework assignment.

CLASS OUTLINE:

Discussion on homework assignment for tonight as well as library work day tomorrow. Progress check on your independent research project.
Touch base on poster presentation preparation. We will either begin presenting projects today or have an additional 15 minutes to work on the posters to present on Friday. There will also be a transcription/translation (protein synthesis) quiz on Friday.
Tomorrow is a library work day for your independent project. Homework must be completed in order to be able to use the library for research.

HOMEWORK:

Study… there will be a short in class quiz on transcription/translation and the cell parts involved on Friday.
Prep for your presentation tomorrow.

Complete homework worksheet on your independent experimental project so that you can work in the library tomorrow.

March 25th 2008
Biology, 1st – 4th periods
Mrs. Sabo
Tuesday

STUDENT OBJECTIVE:
Students will be able to:

Students will gain understanding of protein synthesis, transcription and translation.
Students will understand what parts of the cell are involved in protein synthesis.
Students will be able to construct proteins using the genetic code/decoding process.

CLASS OUTLINE:

Students will finish their posters for their presentations tomorrow.
There might be a quiz the last 10 minutes of class depending on progress and use of class time.
Presentations will begin right when you come to class on Wednesday so if you aren’t finished, someone has to take it home and finish it before tomorrow’s class period. USE YOUR TIME WISELY.

DNA Gene Sequence: CCTGCAGAATTCGTTGAATTCAAT

PROTEIN SYNTHESIS – Include these three main ideas.

TRANSCRIPTION                     TRANSLATION                   END
Nucleus                                          ER                                           Golgi
DNA – gene (see above)                mRNA                                     Protein
mRNA                                           Codon                                      Vacuoles
Nuclear Pore                                  Amino Acids
Cytoplasm                                      Proteins

HOMEWORK:
*Study… there will be a short in class quiz on transcription/translation and the cell parts involved tomorrow if we don’t get to it today. Work on your independent research project.

March 24th 2008
Biology, 1st – 4th periods
Mrs. Sabo
Monday

STUDENT OBJECTIVE:
Students will be able to:

Students will gain understanding of protein synthesis, transcription and translation.
Students will understand what parts of the cell are involved in protein synthesis.
Students will be able to construct proteins using the genetic code/decoding process.

CLASS OUTLINE:

Students will get into groups and create a poster showing the cell parts and protein synthesis occurring. It can be a diagram or it can be cartoon format
Students need to use the DNA gene nitrogen base sequence from the board and include the terms listed as well. After completion of the posters you will present your ideas to the class.
Short lecture will be given at the beginning of the class period to go over the cell parts and protein synthesis one more time before your posters begin. There will be a prize for the best poster/presentation of protein synthesis.

DNA Gene Sequence: CCTGCAGAATTCGTTGAATTCAAT
TERMS: Protein Synthesis, Transcription, Translation, Nucleus, Ribosomes, Nuclear Pores, Cytoplasm, Codon, Amino Acid, mRNA, Endoplasmic Reticulum, Golgi Apparatus, Vacuoles, Protein

HOMEWORK:
*Study… there will be a short in class quiz on transcription/translation and the cell parts involved tomorrow.

March 20th 2008
Biology, 1st – 4th periods
Mrs. Sabo
Thursday

STUDENT OBJECTIVE:
Students will be able to:

Students will gain understanding of protein synthesis, transcription and translation.
Students will understand what parts of the cell are involved in protein synthesis.
Students will be able to construct proteins using the genetic code/decoding process.

CLASS OUTLINE:

Stamp will be given for yesterday’s work for those who did not receive stamps yesterday.
Students will work on the transcription translation worksheet to decode DNA messages into English phrases. This should be done ONE THE WORKSHEET and turned in to teacher before leaving.
Second period lab notebooks will be collected for the weekend.

HOMEWORK:
No homework over the weekend J.

March 19th 2008
Biology, 1st – 4th periods
Mrs. Sabo
Wednesday

STUDENT OBJECTIVE:
Students will be able to:

Students will gain understanding of protein synthesis, transcription and translation.
Students will understand what parts of the cell are involved in protein synthesis.
Students will be able to construct proteins using the genetic code/decoding process.

CLASS OUTLINE:

Stamp will be given for background and work cited, as well as hypothesis in lab notebook. Will get a stamp for each one (total of 3 today)
Students will work with their table partner on the hand-out regarding transcription, translation, and mutations effect on protein synthesis. DO NOT WRITE ON THIS HANDOUT, but do all work in your lab notebook.
Upon completion of the activity in your lab notebook, answer questions 1-3 in your lab notebook. All must be completed by end of period (or tomorrow if not completed in class time)

HOMEWORK:
**If you have not turned in your elephant lab formal lab write-up, tomorrow is the last day to turn it in for partial credit.

**Finish activity/questions if you have not done so during class time.

March 18th 2008
Biology, 1st – 4th periods
Mrs. Sabo
Tuesday

STUDENT OBJECTIVE:
Students will be able to:

Students will gain understanding of protein synthesis, transcription and translation.
Students will understand what parts of the cell are involved in protein synthesis.
Students will be able to construct proteins using the genetic code/decoding process.

CLASS OUTLINE:

Lecture and short video on protein synthesis
Transcription
Translation
Differences between RNA and DNA

HOMEWORK:
Background, Hypothesis and Work Cited due in lab book tomorrow!!!

LECTURE INFORMATION:

DNA & RNA – How are they different?

DNA	RNA
Double Strand	Single Strand
Dioxyribose – Sugar	Ribose - Sugar
Thymine	Uracil
Found in the nucleus in Eukaryotic cells	Found in cytoplasm and in ER of Euk cells

Protein Synthesis has 2 steps

TRANSCRIPTION	TRANSLATION
*mRNA* – Messenger RNA is created from DNA strand – Occurs in the nucleus	Once the mRNA is created it can be read in triplicate pairs (three nitrogen bases in a row) known as a CODON.
DNA strand separated, strand opens with *RNA Polymerase*	EXAMPLE AAACCCTAGCATAGC = sense strand
DNA has *codon* to START or STOP the making of a protein	CODONS ARE AAA CCC TAG CAT AGC
A COPY of the DNA is made by transcription (COPY = mRNA) which leaves nucleus finds ribosomes	tRNA will read the mRNA and attach the correct AMINO ACID to the location to create and build the protein.
mRNA is only made from the “*sense strand*” side of the code.	tRNA is found in the ribosomes so this is the place that TRANSLATION occurs
Other side of the DNA is the *antisense* strand and will not be made into mRNA	RIBOSOMES – Workers that build proteins (put together your motocycle)
DNA is turned into RNA by pairing with the *complement nitrogen base* except RNA doesn’t have T but uses U instead (Uracil)	RIBOSOMES WORK IN THE FACTORY CALLED THE ENDOPLASMIC RETICULUM (the shop where motorcycles are made).
Antisense - TTTGGGATCGTATCG Sense - AAACCCTAGCATAGC	PROTEINS MADE IN THE FACTORY WILL TRAVEL TO GOLGI APPARATUS TO BE PACKAGED AND SENT TO LOCATION OF NEED (motorcycles go on hauling trucks to motorcycle selling shop)
UUUGGGAUCGUAUCG mRNA would be:
mRNA leaves the nucleus through “pores” and finds the ribosomes / ER where proteins can then be made

March 17th 2008
Biology, 1st – 4th periods
Mrs. Sabo
Monday

STUDENT OBJECTIVE:
Students will be able to:

Students will gain understanding of protein synthesis, transcription and translation.
Students will understand what parts of the cell are involved in protein synthesis.
Students will be able to construct proteins using the genetic code/decoding process.

CLASS OUTLINE:

Students will turn in their Elephant DNA lab formal write-ups.
Students will read and take cornel notes on pages E178-E180 (just to the top yellow section) of textbook supplied in class.
Last 15 minutes of class teacher will lecture about mutations within genes and how they affect the code / protein created.
Will also remind students that their Background, work cited, and hypothesis is due on Wednesday of this week, in lab notebook. My suggestion is to type it up and secure it into your lab notebook so that you already have it saved on your computer for your final drafting.

HOMEWORK:
None

LECTURE INFORMATION:

*Think of DNA as a book of direction on how to build a motocycle.

*Sometimes, in that book of directions you will have typo’s occur, even after much proof reading by the editors of the book.

*These “Typos” are called “Mutations” in DNA.

*If the typo is in a part of the directions that makes an important part of the working of the motorcycle, then that motorcycle might not be put together correctly and thus it may not work the way it was intended to work.

In this scenario, the motorcycle is the “protein,” the direction book is the “DNA direction book” and the Typo is the “mutation.”

March 14th 2008